Contributions to Zoology, 86 (4) – 2017Kennet Lundin; Tatyana Korshunova; Klas Malmberg; Alexander Martynov: Intersection of historical museum collections and modern systematics: a relict population of the Arctic nudibranch Dendronotus velifer G.O. Sars, 1878 in a Swedish fjord

To refer to this article use this url: http://ctoz.nl/vol86/nr04/a04

Materials and methods

Historical museum specimens

next section

A total of 117 specimens of the Dendronotus robustus species complex (Table 1) from the Gothenburg Natural History Museum (GNM), the Swedish Museum of Natural History, and the Oslo Natural History Museum (NHM-UIO) were investigated, including a study of both external and internal features. The majority of the specimens had been examined and determined as Dendronotus robustus by the nudibranch specialist Nils Odhner between the 1910s to the 1930s. Five of the specimens from the Gothenburg Natural History Museum were sent as loan to the Zoological Museum in Moscow for morphological investigation. Two specimens (GNM 3026 and 3027) were dissected and SEM-studies of their radula were performed (Figure 1, Table 1). Additionally, AM checked all previously identified as D. robustus specimens while he visited GNM in August 2017.

FIG2

Figure 1. Dendronotus velifer, two historical specimens from the Gullmar Fjord. a–c: habit of specimen 26 mm in length (GNM 3026); f–h: habit of specimen 13.5 mm in length, dorsal, ventral and lateral views respectively (GNM 3027); . d–e: radula of specimen GNM 3026; i–k: radula of specimen GNM 3027, central and lateral teeth respectively; l, jaw; n, o: lectotype, Barents Sea, Vadsø, NHM-UIO nr. 16174. m: genital openings and copulative apparatus. Scale bars: d, i: 100 µm; e, j, k: 30 µm; n, o: 5 mm. Photographs by Tatiana Korshunova (a-h, m) and Karsten Sund (n, o).

FIG2

Table 1. Historical specimens of Dendronotus velifer G.O. Sars, 1878 from Swedish and Norwegian museums.

Specimens collected on recent expeditions

A total of 15 specimens of the Dendronotus robustus species complex were collected alive during marine biological expeditions in the Barents, Kara, and Laptev seas (Table 2; Figs. 2, 3) in this study and earlier. These specimens were all deposited in the Zoological Museum of Moscow State University (ZMMU, Op-296, Op-343, Op-344, Op-348, Op-390, Op-391, Op-392, Op-393, Op-546, Op-547).

FIG2

Table 2. List of recently collected specimens of D. velifer (Figure 2a–e) and of D. robustus (Figure 2j–m) which were utilised for the molecular study.

Morphological analysis

The external and internal morphology was studied under a stereomicroscope and using a full-frame digital camera (Nikon D-810). The buccal mass of each specimen was extracted and processed in 10% sodium hypochlorite solution to extract the radula and the jaws. The jaws of each species were analysed under a stereomicroscope and then photographed. The radulae were coated and examined and photographed using a scanning electron microscope (CamScan). The reproductive systems were also examined using the stereomicroscope.

Molecular and statistical analyses

All 15 specimens of the Dendronotus robustus species complex from the Barents, Kara, and Laptev seas were sequenced in this study and earlier for the mitochondrial genes cytochrome c oxidase subunit I (COI) and 16S, and sequences of one specimen were obtained from GenBank (see Table 2 for list of samples, localities, and voucher references). No historical museum specimens were able to be sequenced because their extracted DNA was in a degraded state.

Small pieces of foot tissue were used for DNA extraction with Diatom™ DNA Prep 100 kit by Isogene Lab, according to the manufacturer’s protocols. Extracted DNA was used as a template for the amplification of partial sequences of the COI and 16S. The primers that were used for amplification were LCO1490 (GGTCAACAAATCATAAAGATATTGG (Folmer et al., 1994)); HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al., 1994)); 16SarL (CGCCTGTTTAACAAAAACAT (Palumbi et al., 2002)); 16SR (CCGRTYTGAACTCAGCTCACG (Puslednik and Serb 2008). Polymerase chain reaction (PCR) amplifications were carried out in a 20 μL reaction volume, which included 4 μL of 5x Screen Mix (Eurogen Lab), 0.5 μL of each primer (10 μM stock), 1 μL of genomic DNA, and 14 μL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95°C, followed by 35 cycles of 15 sec at 95°C (denaturation), 15 sec at 45°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72 °C. The 16S amplification began with an initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 sec at 95°C (denaturation), 15 sec at 52°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72°C. Sequencing for both strands proceeded with the ABI PRISM® BigDye™ Terminator v. 3.1. Sequencing reactions were analysed using an Applied Biosystems 3730 DNA Analyzer. Protein-coding sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank (Table 2).

Original data and publicly available sequences were aligned with the MUSCLE algorithm (Edgar 2004). Separate analyses were conducted for the data sets; the resulting alignments being 658 bp for COI, 443 bp for 16S. The program Mega7 (Kumar et al., 2016) was used to calculate the uncorrected p-distances between all the sequences and dis­tances within and between groups.

To evaluate the genetic distribution of the different haplotypes the haplotype network for both the COI and for 16S genes were reconstructed using the Population Analysis with Reticulate Trees (PopART, http://popart.otago.ac.nz) with the TCS network method. Usefulness of the haplotype network analysis for the delineation of the nudibranch species have been demonstrated recently (e.g. Padula et al., 2014; Furfaro et al., 2016) Bathymetric data were evaluated statistically using nonparametric Mann-Whitney rank sum tests.