Contributions to Zoology, 86 (4) – 2017Kennet Lundin; Tatyana Korshunova; Klas Malmberg; Alexander Martynov: Intersection of historical museum collections and modern systematics: a relict population of the Arctic nudibranch Dendronotus velifer G.O. Sars, 1878 in a Swedish fjord
Materials and methods

To refer to this article use this url: http://ctoz.nl/vol86/nr04/a04

Molecular and statistical analyses

All 15 specimens of the Dendronotus robustus species complex from the Barents, Kara, and Laptev seas were sequenced in this study and earlier for the mitochondrial genes cytochrome c oxidase subunit I (COI) and 16S, and sequences of one specimen were obtained from GenBank (see Table 2 for list of samples, localities, and voucher references). No historical museum specimens were able to be sequenced because their extracted DNA was in a degraded state.

Small pieces of foot tissue were used for DNA extraction with Diatom™ DNA Prep 100 kit by Isogene Lab, according to the manufacturer’s protocols. Extracted DNA was used as a template for the amplification of partial sequences of the COI and 16S. The primers that were used for amplification were LCO1490 (GGTCAACAAATCATAAAGATATTGG (Folmer et al., 1994)); HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al., 1994)); 16SarL (CGCCTGTTTAACAAAAACAT (Palumbi et al., 2002)); 16SR (CCGRTYTGAACTCAGCTCACG (Puslednik and Serb 2008). Polymerase chain reaction (PCR) amplifications were carried out in a 20 μL reaction volume, which included 4 μL of 5x Screen Mix (Eurogen Lab), 0.5 μL of each primer (10 μM stock), 1 μL of genomic DNA, and 14 μL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95°C, followed by 35 cycles of 15 sec at 95°C (denaturation), 15 sec at 45°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72 °C. The 16S amplification began with an initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 sec at 95°C (denaturation), 15 sec at 52°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72°C. Sequencing for both strands proceeded with the ABI PRISM® BigDye™ Terminator v. 3.1. Sequencing reactions were analysed using an Applied Biosystems 3730 DNA Analyzer. Protein-coding sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank (Table 2).

Original data and publicly available sequences were aligned with the MUSCLE algorithm (Edgar 2004). Separate analyses were conducted for the data sets; the resulting alignments being 658 bp for COI, 443 bp for 16S. The program Mega7 (Kumar et al., 2016) was used to calculate the uncorrected p-distances between all the sequences and dis­tances within and between groups.

To evaluate the genetic distribution of the different haplotypes the haplotype network for both the COI and for 16S genes were reconstructed using the Population Analysis with Reticulate Trees (PopART, http://popart.otago.ac.nz) with the TCS network method. Usefulness of the haplotype network analysis for the delineation of the nudibranch species have been demonstrated recently (e.g. Padula et al., 2014; Furfaro et al., 2016) Bathymetric data were evaluated statistically using nonparametric Mann-Whitney rank sum tests.